Strategy Development Format of JB Hi-Fi Essay Example | Topics and Well Written Essays - 5000 words

Strategy Development Format of JB Hi-Fi - Essay Example The company has to enhance its appeal to the target audience comprising consumers in the age group of 18-23 years and hence it has to emanate a youthful image that will ensure maximum footfall from these young, energetic individuals. The IMC strategies of JB Hi-Fi are centered on the fundamental objective that it has to draw the attention of its target audience through a lively atmosphere as well as consumer-friendly and helpful personnel that are dedicated to provide unparalleled customer delight. Moreover, the company must bank on its virtual consumer interface through an efficient website and electronic catalogues to enhance its brand awareness among customers. Other genres of media such as television, magazines, newspapers and periodicals will also be of great use in communicating the brand proposition of JB Hi-Fi and will help the company maximize its market penetration as well as brand image. JB Hi Fi is one of the largest Australian retailers of home entertainment products. Th e company offers some of the world’s most popular brands of speakers, Hi-Fi, DVDs, VCRs, car sound, cameras, home theatres, portable audios and computers. JB Hi Fi is also renowned for offering the largest range of recorded music, video games, DVD movies and DVD music. Products are available in both online store as well as traditional brick-and-mortar stores. It is revealed from the primary research that a major portion of JB customers are male. It is found that almost 67% of the customers are male.

Wars of the Roses 1455-1471 Essay Example for Free

Wars of the Roses 1455-1471 Essay Within the context of the period 1337-1471, to what extent can Henry VI be held primarily responsible for the Wars of the Roses 1455-1471? When Henry VI came to the throne in 1431, people already had high expectations of him. At only 8 years old, he had already broken tradition by becoming the first king to rule over both England and France. However, when the minority council finally permitted Henry VI to rule of his own accord, he seemed to be a hopeless King, making severe mistakes that ultimately contributed to beginning of the Wars of the Roses in the period 1455 to 1471. However, there is some debate amongst historians as to whether Henry VI can be held primarily to blame for causing the Wars of the Roses, or whether other factors such as the over mighty subjects, the feuds between noble, and the actions of Margaret of Anjou were greater contributing factors to the outbreak of war. Henry VI’s personality has been criticised by many historians as being unsuited to the role of king. Contemporary interpretations of Henry are that he was terrible at ruling, as he was â€Å"utterly devoid of wit or spirit† (according to Pope Pius II). Subjects who were condemned for speaking ill of the king in the 1440s and 1450s referred to him as â€Å"a sheep†. Victorian views on Henry VI were that he lacked the qualities required for successful kingship, although at that time he was still praised for being â€Å"a pious, humane and Christian character†. The historian Antonia Fraser concludes that â€Å"these were not the attributes of a king and the truth is that Henry had no real wish to act like one†. This suggests that henry’s personality was overall, entirely ill-suited for the role of kingship. Henry’s chaplain John Blacman (writing during the reign of Henry Tudor), although writing somewhat positively about Henry VI, chooses to avoid mentioning Henry VI’S ability to rule and instead focuses on how religious Henry VI is, describing him as â€Å"chaste and pure from the beginning of his days†, and presenting him as a pious and puritanical king. The fact that Blacman puts emphasis on his pious character rather than his ability to rule, suggests that Henry VI was a poor ruler. Dockray comments â€Å"during the reign of Henry VII, at a time when the king was hoping to secure his predecessor’s canonisation†, so this source cannot be trusted. Robin Neillands concludes that â€Å"The accounts of the King’s goodness are largely based on his devotion to religion, at the expense of more pressing secular matters concerning the government of the realm†. The role of the minority council is also an important factor to consider when assessing whether Henry VI was primarily to blame. Henry V had, on his deathbed, made the fundamental arrangements for his son’s minority; Duke John of Bedford was to take charge in France as Regent (as Henry VI was too young to rule), and pursue the war against the Dauphin Charles-while hanging on to Normandy at all costs and maintaining the alliance with Philip the Good, and Humphrey Duke of Gloucester was to keep a watchful eye on England. In 1431, Henry VI was crowned king but the ministers ruled in his stead. This minority council ruled until Henry was in his mid-twenties, well over the normal ruling age, which suggests that Henry VI could not be trusted to rule the kingdom effectively. Gillingham, however, paints a very positive portrayal of Henry VI’s minority. He concludes that it was â€Å"evidence showing that in fifteenth century England there existed a stable political system, con taining in the council an institutional framework within which tensions could be contained and resolved.† K.B. McFarlane referred to Henry VI as â€Å"a baby who grew up to be an imbecile†, and the length of minority supports this view. Contemporary and Yorkist views on Henry VI were that he was a child-like, idiotic king, and that the council made all the decisions for him. The English Chronicle that was published in the 1460s stated that Henry â€Å"was simple and led by a covetous council† and â€Å"that puppet of a king†. Henry is often criticised for relying too heavily on his council, and continuing to support their decisions. Helen Castor states that â€Å"he was proving to be no more capable of leadership as an adult than he had been as an infant†, supporting the view that he was a childlike king incapable of ruing effectively. However, other historians have suggested that Henry VI did in fact take an active role in government, and can be seen as primarily to blame, rather than his minority council. The historian Wolffe claims that the documentation Henry VI signed is proof of his heavy involvement in government. His own involvement in the war in France led to defeat and humiliation, as he pursued his own French policy and made a secret deal with Charles VII to surrender Maine and Anjou, meaning that they lost all of France apart from Calais. By doing this, he had removed two key parts of the empire, making it inevitable for it to crumble. At this point, Henry VI did seem to act of his own accord, as the fact that he made the deal a secret suggest that he knew that many people would disapprove of his actions. All this suggests that Henry was fully in charge of the government and its decisions, and can consequently be blamed for the mistakes made during that time. Another example of Henry playing an active role in ruling is the increase in elevations to the peerage under Henry VI’s rule. During the first thirty six years of the Lancastrian dynasty, only nine elevations were made to the peerage. However, twenty five years later (during Henry’s reign), there were twenty five elevations to the peerage. This massive increase in elevations to the peerage made during Henry’s reign seems to indicate that Henry was in fact playing an active role in ruling. Another reason why Henry VI could be seen as primarily responsible is because his mental collapse during the period 1453-54 left the government unattended, allowing violence to flare up with no authority to deal with it. According to the historian Robin Neillands, it â€Å"flung the whole responsibility for the management of the realm entirely on the Royal Council†, and as a result â€Å"the fragile rule of law in England fell apart†. The quarrel between the Nevilles and the Percies soon escalated into violence in August 1453, despite measures that the Royal Council put in place in a failed attempt to end their quarrelling. However, it is debatable as to whether or not that Henry’s illness made any fundamental change to these events, as he’d already proved himself as incapable of solving these disputes even before his mental collapse. It also led to more conflict between Richard Plantagenet, Duke of York and Somerset. Another key factor to consider is the role of Margaret of Anjou. Henry VI married Margaret, the niece of Charles VII in 1455, when she was fifteen years of age and had no dowry. Some historians have suggested that Margaret was to blame for convincing the king to surrender Maine and Anjou in order to please her, and referred to her as â€Å"the queen who had brought nothing and taken much away†-although as Gillingham points out â€Å"it is unlikely that a fifteen year old girl could wield so much influence within a few months of her arrival at a strange court where most people spoke a language she was yet to learn†. Margaret of Anjou played a pivotal role in the Wars of the Roses, most notably after February 1456, when York’s second protectorate ended, as Margaret managed to establish a power base in the northwest, and also persuade the king to come to Chester, turning the political tide against York. She had successfully stepped into the vacuum left by Henry VI, and continued to play a dominant role in court, creating the Attainment Bill in 1459 to show the extent of her control. Overall, the balance of evidence seems to suggest that Henry was a weak ruler and ill-suited to the role of medieval kingship. He clearly lacked the qualities needed to rule effectively, and there was no clear leadership in any key sphere of government due to Henry’s long absences from power- the minority council ruled in his stead until he was in his mid-twenties, and reappeared when he suffered his mental collapse in the 1450s, and there were others ruling for him. He also failed to stop the feud between York and Somerset before it escalated into violence. He also neglected to stop the quarrels between other nobles. The balance of evidence also seems to point towards the interpretation of Henry VI being far too easily led and manipulated. Helen Castor even goes on to say that he â€Å"did little more than smile and agree to every suggestion his advisers made†. While Jack Cade’s rebellion showed the discontent of the people at that time, the fact that the rebellion was aimed solely against Henry VI’s advisors rather than Henry himself is a clear indicator of how easily manipulated he was, as his own people believed that his advisors were at fault. According to Antonia Fraser, the main demand from the rebels was the punishment of â€Å"the false progeny and affinity of the Duke of Suffolk† and a later chronicler said he â€Å"was simple and led by a covetous counsel†. However, none of this means that Henry VI should be held any less accountable, as he chose the government that was now in place. However, there are other factors that suggest that he wasn’t entirely to blame for the Wars of the Roses. Many historians have identified the family tree of Edward III as a significant factor in causing the wars of the roses for several reasons. One main reason why it could be seen as a significant factor is because it started the debate as to who had the stronger claim to the throne, the house of Lancaster, or the house of York. When Edward II died in 1377, Richard II succeeded him (as Edward the black prince had predeceased his father). However, as she was too young to rule, John of Gaunt ruled in his stead until Richard II turned 20. Richard II banished Gaunt’s heir, Henry Bolingbroke, and Thomas Mobray when they had a quarrel, but made the fatal mistake of seizing all of the wealth of the house of Lancaster. This caused Henry Bolingbroke to return to reclaim his wealth, ultimately ending in Bolingbroke taking the throne of England as Henry IV. By doing so, he ignored the claims of the Mortimer family, which followed back through a woman named Philippa, the daughter of Lionel of Clarence (the second son of Edward iii), and these claims eventually passed down to Richard, duke of York. The Yorkist line seemed to have the stronger claim to the throne than the Lancastrian line, as Richard, earl of Cambridge’s marriage with Anne Mortimer connected his line with the Mortimer line, arguably putting him ahead of the Lancastrians in the line of succession. The debate was that Anne Mortimer was a woman, making Richard Plantagenet’s claim through a female line, so the Lancastrian claim was considered stronger, and also the Yorkist claim was not pursued after 1415, as his father, Richard, earl of Cambridge had been beheaded for treason. This chain of events helped to start off the Wars of the Roses, as it was Richard Plantagenet who founded the house of York. Yet while Edward III’S family tree provided the possibility for war, there are arguably more significant factors. Edward III’s complicated family tree was a factor that drove Richard of Cambridge to attempting to place his brother-in-law, Edmund Mortimer, on the throne, as he believed that Edmund Mortimer had the stronger claim. As it was his son, Richard Plantagenet, who founded the house of York, it suggests that the family tree helped to cause the feud between the house of Lancaster, and the house of York, effectively starting the Wars of the Roses. Henry IV’s usurpation of Richard II in 1399 has been regarded by several historians as the root cause of the Wars of the Roses. In particular, the historian A.L .Rouse stated that â€Å"It all began with a revolution. The revolution of 1399.†When Henry Bolingbroke overthrew Richard II and took the throne, he â€Å"struck at the very foundations of kingship†. During that period, it was believed that the king was always chosen by God. Therefore, it was considered dreadful to overthrow a king, and Shakespeare later described the Wars of the Roses as a form of divine retribution, as punishment for the sins that their predecessors committed. This idea was used as propaganda, and the usurpation was viewed as so shocking that it created the precedent for overthrowing a sacredly anointed king. It also put forward the idea that the divinity of kingship could be passed down to someone else of a stronger bloodline, and Henry IV used this as an excuse by claiming that his ancestor was the eldest son of Henry III. However, there were other contenders to the throne who had a stronger claim than Henry Bolingbroke, and as there was much dispute in later years about who had a stronger claim to the throne, it could be argued that the cause of all these disputes originated. The usurpation of Richard II was also significant because it meant that any person of royal blood who had raised an army, and who had argued with the king could become a contender for the throne, as they could simply overthrow the king and take the crown for themselves. This meant that the throne was never going to be safe from anyone who wished to take it. This made it almost inevitable for war to break out, as any of the following rulers’ claims to the throne could be questioned, and it created political uncertainty and instability due to the fact that the Lancastrian dynasty was based on usurpation. Despite Henry Bolingbroke’s excuse that Richard II had been unfit to rule, it still caused a dispute about whether the usurpation of the throne could really be excused. However, this was not a problem during the reigns of Henry IV and Henry V, and the debate was only brought about when Henry VI’s failings became apparent- had there been a strong, capable ruler on the throne, this debate would not have been reopened. â€Å"Bastard Feudalism† also played a significant role in the Wars of the Roses. The phrase was coined by the historian Charles Plummer. K.B. McFarlane argues that the whole system of bastard feudalism did in fact have the potential to provide stability, suggesting that its contribution to the disorder and instability of that period was merely a reflection of Henry VI’s ineffective rule. This serves to reinforce the argument that it was Henry VI’s inability to rule that created the problems which arose and ultimately culminated in the outbreak of war. Certainly, had a strong king, capable of maintaining control, been placed on the throne, then the system of â€Å"bastard feudalism† would not have proved an issue. It could also be argued that the â€Å"over-mighty subjects such as York and Warwick were to blame for causing the Wars of the Roses. Some historians have argued that Henry VI’s mistrust of York was not justified, as he had legitimate grievances. He had been the king’s lieutenant in France but was replaced by Somerset who was given a larger army. Somerset was even paid  £2 5,000 for troops while York was given nothing and instead told to wait. Somerset’s younger brother was also made lieutenant of France and York was humiliated as lieutenant of Ireland. The government also owed York  £38,666 ( £12,666 of this York agreed to forgo), but they still failed to pay his wages, and even owed him a further  £10,000 due to his hereditary pension. Because of the government’s refusal to pay York the money he was owed, his debt increased to the extent that he was forced to consider selling some of his manors, as well as endanger relationships with his friends by borrowing heavily from them. York also received  £21,000 worth of â€Å"bad tallies†-which were the crown’s method of discharging its debts by handing out tallies on some regular source of income, and receiving the tallies did not guarantee proper payment. Many historians agree that York deserved fairer treatment than this- he had been active in the king’s service abroad and was the crown’s largest single creditor after loaning them  £26,000. The historian Keith Dockray claims that he â€Å"could reasonably expect a prominent role in Henry VI’s council and even, perhaps, formal recognition as the king’s heir†. Many pro-Yorkist chroniclers were of the belief that he was a good person who was being treated very poorly by the â€Å"corrupt clique surrounding the king†(Dockray). The English Chronicle states that â€Å"common people hated Somerset but loved York because he loved the commons and [reserved the common profit of this land†. According to K.B. Mcfarlane, some of the blame can still be attributed to the king, because â€Å"only an under-mighty ruler had anything to fear from over-mighty subjects†. This links back to the key problem underlying all these factors-Henry VI was a poor ruler, and so the stability of the government depended on his ability to assert authority and make good decisions. The development of bastard feudalism, caused by the growth of affinities, also helped to cause instability between the king and his magnates, as it enabled the magnates to subvert the wishes of the crown and take the law into their own hands. According to Neillands, the magnates â€Å"began to maintain bodies of soldiers, even in peacetime, and this â€Å"maintenance† was not illegal â€Å"unless the lord attempted to support his retainer in outlawry or by influencing the court of law†. As a result, violence became widespread due to Henry VI’s inability to maintain control of the system. Gillingham, however, paints a very positive portrayal of Henry VI’s minority. He concludes that it was â€Å"evidence showing that in fifteenth century England there existed a stable political system, containing in the council an institutional framework within which tensions could be contained and resolved.† However, Richard Plantagenet’s contemporaries tended to be more critical when assessing whether he deserved this treatment. The historian J.R. Lander referred to him as â€Å"an ambitious, opportunist and self-interested magnate who failed to win much committed support from his peers†. Many of York’s contemporary critics believed that he was far more motivated by self-interest rather than concern for public good, and some even called him a traitor. This is evident in a Chancery memorandum in 1456 that claimed that all disturbances since Cade’s rebellion had been â€Å"at the will of the Duke of York, descended from the Mortimers’. The fact that he is not only blamed for the disturbances after Cade’s rebellion, but there is also an accusatory remark about his lineage, clearly suggests that he had not won the support of his peers. The Coventry Parliament in 1459 even wrote a catalogue of his alleged treacheries, and the tract Somnium Vigilantes criticised his behaviour as being â€Å"subversive to the commonwealth†. The events in 1452 also support this view; York started a campaign to remove Somerset from power which failed, so he had to resort to an armed force. He also confronted the king at Blackheath with armed retainers, with a view to finally gaining his deserved position beside the king. According to the historian J.R. Lander, one contemporary writer claims that he â€Å"surrendered on the promise that Somerset would be arrested†. However, this failed, as little support from nobles and the common people led to his humiliation. These events suggest that York was indeed ambitious and self-interested with little support. When York returned from Ireland in 1450, many of the king’s servants became suspicious. Despite returning because he was worried about the return of Somerset from France, the king’s servants assumed he was there to overthrow the king due to rumours spread about during that time. This suggests that he certainly did not have the approval of the public, as they were prepared to believe in rumours rather than trusting in his character. Overall, the balance of evidence seems to suggest that Henry VI was primarily responsible for the Wars of the Roses. Henry VI’s incompetence allowed rebellion to take place, and his inability to rule effectively meant that the government was filled with over-mighty subjects all vying for power. He also worsened the disputes between the nobles and increased tensions between them, creating the perfect conditions for war to take place. Although he cannot be blamed substantially for the defeat in France, he did play a role in events by surrendering Maine and Anjou. The usurpation in 1399 also heightened all of these factors, as it encouraged the belief that God was against his rule. None of the key factors responsible for the Wars of the Roses would have been as influential on events if Henry VI had been the dominant, assertive ruler everyone needed him to be. Bibliography: The Wars of the Roses by John Gillingham The Wars of the Roses by Robin Neillands The Wars of the Roses by Antonia Fraser The Wars of the Roses by J.R.Lander Blood and Roses by Helen Castor Bosworth Field and the Wars of the Roses by A.L .Rowse Henry VI and the Politics of Kingship by John Watts

The contribution of motherese or child-directed speech

The contribution of motherese or child-directed speech Language is the standard by which higher intellectual processes are revealed. It is important means of social communication and is one of the exceptional systems of habits which distinguish man from the animals. Differences in language account for many of the distinct contrasts between peoples, and to its deficiency may be attributed the differences between intellectual development. As preverbal infant it is important for caregivers to know how to acquire the fundamental aspects of language more efficiently. Motherese or child-directed speech (CDS) is a pattern of speech which is used for communication with preverbal children. Child-directed speech found to draw children attention more decently due to distinctive characteristics (Brand, Baldwin Ashburn, 2002; Bohannon Marquis, 1977; Fernald Mazzie, 1991; Greiser Kuhl, 1988; Hoff-Ginsberg, 1986; Masataka, 1998; ONeill, Bard, Linnel, Fluck, 2005; Rowe, Pan Coker, 2004; Sokol, Webster, Thompson Stevens, 2005; Tamis-LeMonda Borns tein, 1994). In this study we will investigate the aspects of child-directed speech and the contribution of it to infants language development. First, to describe CDS it is important to underline that for occurrence of CDS an infants or young childs presence is required. Adults, especially mothers, use this pattern of communication by adjusting, their linguistic and prosodic aspects of speech which construct the concept of motherese. Child-directed speech is distinctive by its slower production of utterances, and pitch contours are often pronounced more clearly and exaggerated (Brand, Baldwin Ashburn, 2002; Bohannon Marquis, 1977; Fernald Mazzie, 1991; Greiser Kuhl, 1988; Hoff-Ginsberg, 1986; Masataka, 1998; ONeill, Bard, Linnel, Fluck, 2005; Rowe, Pan Coker, 2004; Sokol, Webster, Thompson Stevens, 2005; Tamis-LeMonda Bornstein, 1994). Several studies indicate that prosodic features of child-directed speech are far more important than its syntactic or semantic features (Greiser Kuhl, 1988). Moreover, studies show that the exaggerated prosody of CDS increases the salience of acoustic cues to linguistic structure for the preverbal infant (Fernald Mazzie, 1991). Additionally, the prosodic features of the maternal speech help infant to distinguish the identical syllables (Greiser Kuhl, 1988). The evidence show, that child-directed speech is characterized by perceptual features which are more attractive to children, although it is important to investigate the contribution of motherese on language development. The study of Greiser and Kuhl (1988) provide us with three general explanations of CDS to contribution to language development. Three major characteristics are described in a study of Greiser and Kuhl (1988) consistent of linguistic, attentional, and social/affective constructs. Linguistic explanation is characterized by expanded pitch contours which serve as indication of linguistic boundaries (Greiser Kuhl, 1988). Moreover, by highlighting the linguistic boundaries make the language explanation more efficient (Greiser Kuhl, 1988). In several studies of syntax growth related to maternal speech, the most frequently appearing predictor of syntax growth is the occurrence in input of expansions, reacts, and other sorts of utterances that repeat some or all of the semantic content of the prior utterance while changing the syntactic form of expression (Hoff-Ginsberg, 1986). In addition, positive effects have been found of mothers utterances that repeat part of the childs previous utterance and of utterances in which mothers or experimenters repeat part of their own previous utterance (Hoff-Ginsberg, 1986).Natura listic and experimental studies have also found the occurrence of yes or no questions in input to be positively associated with measure of childrens syntax growth (Hoff-Ginsberg, 1986). The attentional characteristic of CDS contributes to the level of perceived language by the infant, and the level of prominence of perceived language respectively (Greiser Kuhl, 1988). By using high pitch contours combined with deep emotional expressions contribute to the level and prominence of perceived utterances (Greiser Kuhl, 1988). Moreover, Sokol, et al. (2005) proposes that maternal speech patterns is more suitable for the infants immature auditory system. The study shows , that maternal pattern of speech is adjusting to infants auditory and cognitive abilities. By adjusting to infants auditory and cognitive abilities it is credible to draw and maintain infants attention. Social/affective characteristic of CDS contribute to infants language development by regulating infants affective state (Greiser Kuhl, 1988). In a study of Clarck (as cited in Sokol et al., 2005) suggest that salience regulation of infants affective state may sustain language learning at the early stages of development. The use of higher and expanded pitch contours allow mothers to assign important affective discriminative stimuli and information which will be identified by the infant as positive signals regulating the infants affective state (Greiser Kuhl, 1988; Sokol et al., 2005). Child-directed speech serves to adjust the affective states of the infant depending on whether the caregiver encouraging, soothing or just seeking to elicit the infants attention (Sokol et al., 2005). According to developmental psychologists nonlinguistic representations of the world contribute and constrain the structure of child language and the course of its development (Tamis-LeMonda Bornstein, 1994). What is more, when interacting with infants adults alter their movements in ways that increase infants attention to action and highlight meaningful units within the flow of motion (Brand, Baldwin Ashburn, 2002). Mothers shape their language-related gestures to infants, using fewer gestures over all, and more often gestures to reinforce or disambiguate the verbal message, rather than to add new information (Brand et al., 2002). Gestures associated with child-directed speech called motionese are likely to assist infants attention to action (Brand et al., 2002). Such reinforced attention should help infants to learn about action more readily (Brand et al., 2002). Studies show that mothers showed higher level of enthusiasm and interest in the object demonstrating to infants, which is considered reinforcing behavior for the baby (Brand et al., 2002). Additionally, increased gaze from mothers in mothers infant-directed action, help maintain infants attention and thus can benefit in language and cognitive development (Brand et al., 2002). Overall it is important to evaluate gestures as a part child-directed speech because of their attentional and linguistic contribution to infants development. Child-directed speech or motherese is a universal pattern of speech with preverbal children by caregivers independent of language (Greiser Kuhl, 1988). Some aspects of motherese as motionese could be found in different sign languages, whereas sign motherese shares analogous characteristics with maternal speech (Masataka, 1998). In her study Masataka (1998) found that hearing infants exposed to motherese sign language showed more interest and attraction then to adult sign language. This study support that, special properties evident in infant-directed speech may have universal attentional and affective significance (Masataka, 1998). In addition, it is important to investigate the importance of father talk to infants and their contribution to the language development. Several studies demonstrate the difference in the ways fathers talk to their preverbal infants (Rowe et al., 2004). Fathers in Western middle-class produce more directives, more wh-questions, and more frequent requests for clarification in talk with children, thus engaging children in more complex cognitive processes (Rowe et al., 2004).Fathers tend to use directives in their indirect form which may present cognitive/linguistic challenges in interpretation (Rowe et al., 2004). By addressing the wh-questions the conversation becoming more demanding and require child to respond non-imitatively and verbally (Rowe et al., 2004). Although there are only few studies on paternal talk to the infant it is clear that CDS of father contribute to the language development by putting the child in more complex linguistic and cognitive processes. Concluding it is important to underline aspects of motherese contributing to language development. Child-directed speech or motherese, play an important role in language development of an infant. Motherese prosodic characteristics influence directly the language development because of its slower and smooth production, higher and exaggerated pitch contours and sensitive pause distribution in utterances. Additionally, motherese influence the child affective and attentional states, which contributes indirectly to the language development. Although, there is a lot of evidence about child-directed speech positive qualities there should be more investigation about the contribution of child-directed speech to language development. Word Count: 1337

Free Essays - A Psychological Analysis of Hawthornes Young Goodman Brown :: Young Goodman Brown YGB

My first thought when I read the story is that there's a psychological aspect to this. This aspect comes to life when Brown begins to accept the reality that he seems to repress. Which reality is this? As imperfect humans, we've occasionally used poor judgment on issues in our everyday lives, but what is most important is how we deal with these experiences that will become forever frozen in our minds. I feel that this is the major cause of anguish for Brown. When you look at his society and the beliefs of the townspeople, one can understand how Brown's conscience can be very overbearing. So overbearing that it causes him to have delusions concerning the welfare of his soul. I believe it is a dream or nightmare for Brown, one that he will never be able to deal with. One wonders how Brown's townsfolk deal with their sins. Do they repress them or just keep them hid from others? Through time, Brown learns he is not alone when it comes to dealing with good and evil. Isn't he just dealing with good? Or is it the connection between good and evil that bugs him? His own wife, Faith, is bothered with symptoms: "a lone woman is troubled with such dreams." Brown mentions, "She talks of dreams, too," which is a somewhat reassuring statement for him. This seems to confirm the notion that his "journey" is a fabrication of his unconscious (a dream) and that his wife has similar problems. It's quite ironic that her name is Faith, which seems to be the very thing that she is lacking. Also, Brown is caught offguard when he sees the "journeyman" mingle with Goody Cloyse. He comments: "that old woman taught me my catechism"; such a respectable woman is talking to evil. We are also told of how Brown's family wasn't as wholesome as he believed. His grandfather lashed a Quaker woman while his father set fire to an Indian village. How did these men deal with their actions? I can remember reading about Puritans who used to whip themselves for their sins. This torment can exhaust you to a physical numbness but the sin is still in your mind. Through it all, I wonder about all the hell people were put through, during this time period, for acts that were deemed unacceptable I really like the symbolism in this story.

Child and Young Person Development Essay

Physical Development birth-3years The physical development for this age group is described below: Baby raises head and chest when lying on stomach and supports its upper body with arms when lying on stomach they are able to stretch their legs out and kick when lying on their stomach or back. They are able to open and shut their hands, pushing down on their legs when their feet are placed on a firm surface. At this age sucking and grasping reflexes develop the baby is able to focus and follow objects with eyes and brings hand to mouth. They begin to take swipes at dangling objects with hands their movements become stronger. They learn to co-ordinate their movements. Most 18month olds usually walk by themselves (even though some of them might become quite wobbly or unsteady). At 3years most can use tricycle, jump, hop and climb A child grows and develops at an astonishing rate during their first 3years of growing stages. Therefore a child’s body grows stronger, in which they start to develop co-ordination movements, By the time a baby reaches their first birthday, they begin to support large amounts of weight and pulls themself up to their feet, standing this is the beginning of walking. As a result an 18months old child will be capable to walk by themselves even though some of them might become quite wobbly or unsteady, also by the age of 3 years a child might be able to run, jump, hop, climb a climbing frame with little support and pedal a tricycle to get around easily. By the age of 2years a child may master scribbling with a large piece of crayon also by 3 years old they develop the skill to thread a large beads and also try to build a tower with eight or more blocks depending on how balanced and flexible they might be. Babies do not start their walking breakthrough with perfect pace. There is much shuffling, toe walking. The leaning for the baby’s legs to bob out will usually correct itself by the age of 3 years old. Communication and Intellectual Development At this age they watch faces intently following moving objects recognises familiar objects and people at a distance, they start using hands and eyes in coordination smiling at the sound of familiar voice. They smiles and coo in response to others and begins to imitate movements and facial expressions e. g. Sticking out tongue and begin to babble, imitating sounds. They are able to turn their head towards the direction of sound. This stage of development children will make development in both communication and thinking skills. Generally some children might communicate by crying by expressing their feelings that rely on reflex behaviour and simple baby language to children who can speak full sentences, ask questions and use their mind to solve problems to workout things for themselves. A 5year old can communicate using simple sentences and usually understand simple language. Social, Behavioural and Emotional Development At this age they begin to develop a social smile enjoys playing with other people and may cry when playing stops. They become more communicative and expressive with face and body Imitating some movements and facial expressions. Throughout children’s first 3 years of life they will have advanced a lot. A baby will become totally depending on their careers or parents for all of their care. Children become confident and independent individuals by the age of 3years old. But at the age of 3 years old children will become upset when they are faced with separation situations, such as starting nursery or if left with someone else (stranger) other than family members such as a mother or a father. Physical development 3-5 years Children of this age are able to walk in a straight line, backwards, and up and down stairs. They hop on one foot and are able to use paints, scissors, pencils, and crayons to purposefully create shapes, faces, and letters. They are likely to have bladder and bowel control and are able to dresses and undress themselves, feed themselves and do simple chores with assistance and direction. Children start to carry out more body co-ordination movements and start growing in confidence as a result and learn to control their gross motor skills more skilfully. Between three and five years, children’s confidence grows as they start to explore and look for answers and reasons for everything in their world. They love being praised for trying and like to try everything themselves. Both three and four-year-olds are likely to be very active because they are trying to develop their running, climbing and balancing skills. They need plenty of time outdoors to be able to do this. Although many children at four are experts at climbing, they will generally only attempt what they can manage safely. They still need supervision, however, as they sometimes can climb up an object and then are not able to get down without help. Children will start to engage in imaginary play, and pretend to be animals or fairies, or adults like mums or dads, teachers or doctors. Children by the age of 5years develop their fine motor skills as they are learning how to use their controlling skills in order to complete more complex tasks. At the age of 5 years many children can hop, jump and skip as some 5year olds will use a leading hand (either right or left). Communication and intellectual development †¢ Always asks â€Å"Why? † †¢ Uses longer sentences. †¢ Grammar improves. †¢ Starts to understand the difference between real and imaginary. †¢ Listens to, and understands, short stories. †¢ Sings simple songs and recites rhymes from memory. †¢ Has a very active imagination. Children start to understand more challenging theory (like time) and will sense problem-solving skills to work things out for themselves. At this stage their language skills progress very rapidly as the child’s vocabulary expands and they constantly ask questions. Generally on the whole three year olds have wide vocabulary and they can communicate using complex sentences that are most grammatically correct. At this stage children have an active imagination; they listen to, and understand short stories and might tell you their own version of the story. Children can use proper grammar as they are developing and start to ask questions such as why, where and when. They will start to use long sentences to try and explain things, they will sing and dance along to music’s or even they will recites rhymes from memory. Social, emotional and behavioural development At this age the child is able to ever more identify and put a name to their own feelings. They are also able to use words instead of actions to express feelings. They may start to develop fears include real (the dark, animals, and thunderstorms) and imaginary (monsters, ghosts) subjects and may exaggerates and tells â€Å"tall tales†. They enjoy talking about body functions, a sense of humor develops as the begins to share and take turns. This stage of development they start to hit less but will use name calling more, will enjoy playing with other children more at this stage. Children use pretend play more and use their imaginative and theme based to play mamas and papas. Children like to talk and will talk none stop, children enjoy playing group activities and games with other children or by themselves. At the age of three or five years children might undergo numerous changes and for most children this is the stage where they will be starting nursery and then going on to school. Therefore they will have new experiences which is challenging for children but this helps them to learn about managing their feelings and behaviour and develop social skills like sharing and playing together. Between three and five years children are able to understand consequences of behaviour and also the concept of ‘getting in trouble’. Physical development 5-8 years At this age a child may begin to lose baby teeth is able to dress self with little assistance, they learns to skip, throws a ball overhead catches bounced balls rides a tricycle skilfully; may show interest in riding a bicycle with training wheels. This age group is able to balances on either foot for 5-10 seconds, they are able to use fork and knife well, can confidently cut with a scissors, at this stage left or right hand dominance is established. This child walks down stairs, alternating feet without using a handrail; they are able Jumps over low objects, run, gallop, and tumble. They can skip and run on tiptoe and jump rope. They are interested in performing tricks like standing on head, performing dance steps and are capable of learning complex body coordination skills like swimming, ice or roller skating, and riding bicycles. They may be able to tie shoelaces and are able to copy simple designs and shapes. Between five and eight years children develop better co-ordination and more stamina of their gross motor skills. At this stage children become more skilful with their controlling abilities, they also develop team games such as football as it is a very popular game with children especially with boys. This stage of development children are learning to ride a bike with stabiliser, they also have developed the sense of rhythm and enjoy dancing and movement activities. On the whole a 5 year old can tiptoe or run, they will understand time, they have mastered the alphabet, can use simple correct grammar really well and they play really with other children and they can put on their own shoes by themselves. Most five year olds can walk backward, walk heel-to-toe without losing balance, run on toes, hop proficiently, get up without using hands, balance on alternate feet (eyes open or closed), catch a ball using hands more than arms, jump rope and jump down several steps at a time. Communication and intellectual development At this age children are able to use 5-8 words in a sentence, they might like to argue and reason; use words like â€Å"because†. They would know basic colours like red, yellow, and blue, green, orange and are able to memorize their address and phone number. The child at this age understands that stories have a beginning, middle, and end and is able to remember stories and repeat them, they also enjoys creating and telling stories and develops an Understanding, that books are read from left to right, top to bottom. At this age a child enjoys riddles and jokes, draws pictures that represent animals, people, and objects. They enjoy tracing or copying letters and can place objects in order from shortest to tallest. They can understand and use comparative terms like big, bigger, or biggest and are able to Sorts objects by size. They can also identify some letters of the alphabet and a few numbers (if taught). They are able to understand â€Å"more,† â€Å"less,† and â€Å"same† and can count up to 10 objects. They recognises categories eg these toys are all animals, these are all toys and understand position of an object. Their dramatic play is much more elaborate and complex and they can maintain a good attention span concentrating well. They develop curiosity and are interested in cause and effect and can understand time concepts like yesterday, today and tomorrow. Children’s great deal of learning takes place in school, while children are in school they develop their skills in literacy such as (reading, writing, speaking and listening) and their understanding of problem solving and reasoning. By the age of eight years children use logical thought. Social, emotional and behavioural development At this stage of development children start to invent games of their own with friends with simple rules and they will organise toys and pretend play with the other children. Children this stage start to confuse between what is a fantasy and reality and might contracted themselves. Every now and then children have fears of loud noises, the dark, animals, and on occasions of some people. This stage children might start to develop ownership or taking control of things and might not want to take turns and share things with others but doesn’t always want to. Children express anger in many different ways; they might hit another child because they were not given the chance or choice to have a turn in playing the same games and sometimes will get jealousy. Occasionally children try to test their muscular strength and motor skills, but are not emotionally ready for competition. Children time and again might exclude other children in play only wanting to stick with best friends, children develop the use of swear words or from time to time â€Å"bathroom words† in order to gain attention from peers or teachers. They can sometimes be very bossy, likes to try new challenges and take risks, and carries on conversations with other children and adults. They want to make decisions for themselves of what they want to do or eat and dress as. They start to develop an understanding of others feelings and might become aware of another child becoming angry or sad. Children might choose company of 1 or 2 children at a time and might even become bossy or sulky when others join in. A child might like to feel grown up; boasts about self to younger, less capable children. They begin to have a very basic understanding of right and wrong. They start to play contentedly and independently without needing a constant supervision; sometimes they take turns or shares with others but might feel a little bit hesitant. A child might sometimes ask for permission, shows respect and understands rules, they understand and enjoys both giving and receiving, enjoys collecting things and at times needs to get away and be alone, children develop understanding of relationships and similarities and differences in other families, a child will seek an adults approval and sometimes be critical of other children and might be embarrassed by own mistakes. They are less fearful of the world than they are of toddlers because they understand the world better, has a good sense of humour, and enjoys jokes and laughter with adults and peers. Children are becoming much more mature and independent. Children are increasingly independent, undertaking most physical care needs for themselves. They enjoy group play and co-operative activities. By this age children have increase sense of personality and gender are developed. Through improved language skills, therefore children are much more of expressing their feelings and managing their behaviour. By this stage children have established friendship and they become much more confident in social situations. Physical development 8-12 By this stage children develop their puberty for both girls and boys from the around the age of 9 and for some girls they may even start to menstruate around the age of 10 or 11 years old. But for most boys puberty starts later at around 13 or 14 years old and this can lead to some self-consciousness between boys and girls. Boys starts get to develop a deepening of their voice and will start to build up apple in their throat. Boys will begin to have growth of their testicles and penis and start to grow pubic hair, most will have spontaneous erections and wet dreams. Communication and intellectual development At this stage children’s thinking skills is developing maturing and most ten years old can now understand abstracts ideas such as (like feelings). Consequently children’s reasoning and problem solving skills becomes more established and also most ten years old can complete quiet complicated calculations. By this stage children will start that enjoy conversing with each other and chatting in friendships groups. Social development †¢ Girls and boys that develop early are often self-conscious of their body and a target for teasing †¢ Your child may become interested in experimenting with holding hands, hugging and kissing other boys or girls Children at this stage may feel unsettled when making transition from primary school to secondary school and as puberty approaches. Most children may find the transition to secondary challenging and demanding might as well experience intense anxiety and real fear the transit to secondary school. Which therefore can leads to problems with self-esteem and as a result some children become victims of bullying. Most children become independent and might make decision more; also they may play unsupervised at times. At this stage children may travel to school by themselves towards and by the end of age band. As they hit teenage stage they develop mood swings. They will also have conflict with parents/careers due to desire for more independence such as why can’t I stay home alone. They also find that rules are unfair (but all my friends are allowed to do it), they will also start challenging rules to see what happens and may also refuse to go along with some decisions made by parents/careers. Physical development 12-19 years By fifteen or sixteen years of age for most girls the process of puberty is completed. On the other hand for boys puberty starts around the age of fourteen years. For both boys and girls their body changes rapidly throughout puberty, even though some boys grow very rapidly, this can lead to some degree of clumsiness and poor spatial awareness. At this stage some children might develop some talents in sport activities. They might even learn or refine controlling skills such as drawing, stitching, carpentry, woodwork and playing instrument. Communication and intellectual development Young people will be faced with challenges in school as they will preparing for examinations and start to think about their future. At this stage of development children’s academic knowledge stats to increase as exam curriculum is followed towards aged sixteen, as a result decisions are made about their future goals such as (college course and university careers). They might become reluctant to directly as adults for advice or information they need. Young people may prefer to access information or advice as anonymously. Young people might become stressful due to the pressure to achieve and succeed becomes a powerful force. Young people’s communication is carried out in number of through electronic means such as text message ia mobile phones, emails or social networking sites such as facebook, twitter and instagram. Social, emotional and behavioural development Young people desire to express understanding starts to develop while at the same time they form strong desire to fit in with peers become apparent and interest in the opposite sex, and also in own sexuality. They might express themselves through creatively such as art/music/dance/drama and even in creative writing. Young people may experience mood swings and they may disregard the opinions/values of parents/careers if they conflict with those of the peer group. As a result many young people experience their first romantic relationships at this stage and this can lead to some complicated emotions for them to manage. Consequently these stages of development young people become overly concerned about their appearances such as weight or body image. In some cases this leads to eating disorders, low self-esteem and depressions. Sometimes young people swing between acting maturely and saying/doing ‘childish things’. Young people are more likely to communicate their inner thoughts and feelings more frequently to friends than they are with adults.

buy custom The Healthcare Reform essay

buy custom The Healthcare Reform essay While the debate on health care reform ranges on, Democrats and Republicans are taking opposing sides. Democrats want a government-run health care while Republicans are for state-moderated health care policies. In between these two stances, we have one overdue reform that must be addressed if at all the founding American spirit is still alive. This singular reform requires no sides, no political will or economic back up. It only needs us to be human. Americans with pre-existing conditions, especially of terminal diseases like cancer, diabetes, Aids, heart complications etc, have been bared from accessing medical coverage in the last three decades (George, 2007). The few insurance covers available for them are so expensive that, when coupled with their ever-rising and perpetual medical bills accrued when managing the conditions, the covers are impractical and exploitative. The very citizens, whose love for the nation endures, the ones we walk alongside on the streets, are being denied medical cover just because they were unlucky enough to get terminal diseases. This are our fathers, mothers, brother, sisters, sons and daughters. It is time thatCongress revoked the spirit of individualism, the spirit of the dead burying their dead, and revives the very spirit of unity that was the foundation on which our nation took shape. America is defined by unity, by nationalism and by virtues of equality. Congress should, as urgently as yesterday, concur in ending the barriers that deny coverage to terminally sick Americans who are in need of medical assistance. This is not about costs of healthcare, it is not even about state control of a vibrant industry, it is not about doctors and health plans security, it is not about jobs and investments, it is about being human. A window surviving on a cent-worth salary to bring up her four children may never access medical coverage in her youthful life. However, when the children grow up, they may decide to reward her love and devotion with a medical cover, only that by that time she has already been diagnosed with cancer. Today, such a woman, a hero to the American economy, one who shares in the responsibility of building the nation, paying taxes and modeling the lives of American youths, is left by the sidelines because she was foolish enough not to get medical cover before developing cancerous cells. Is that Ameericanism? She represents a million and one patriots of this nation who cannot access medical cover because of preexisting conditions at the time when they can afford such a cover (George, 2007). Congress can formulate genius policies to correct this injustice and inhuman situation. For instance one such policy can be formulated as, The law shall deem any denial of medical cover to an interested party as discrimination. To cater for additional risks in covering persons with preexisting conditions, the premiums must not also be increased beyond those of persons without pre-existing conditions. It shall however be legal to reduce the amounts payable to claims made by persons with preexisting conditions. Teddy Roosevelt called for reforms because there was something innate in being American. Something brotherly, something borne of consciousness to do good, something that makes us the single greatest nation on earth. Almost all facets of US health care reform cannot wait, but this one must not wait. Abolishing the barriers that discriminate our sick loved ones from medical coverage is something American, irrespective of our Democrat or Republican orientation. Buy custom The Healthcare Reform essay

Identification of Human Parechovirus in clinical samples Essays

Identification of Human Parechovirus in clinical samples Essays Identification of Human Parechovirus in clinical samples Essay Identification of Human Parechovirus in clinical samples Essay Introduction The viral genus Parechovirus belongs to the household of Picornaviridae which are non- enveloped, plus strand, RNA viruses. Human Parechovirus and Ljungan virus are the two species belong to this genus. The Ljungan viruses are virus of gnawers, were isolated from bank field mouses in Sweden from a patient infected with myocardial inflammation. It portions similarity with Human Parechoviruses. The Human Parechovirus consists of 14 genotypes: HPeV-1 to HPeV-14. The HPeV-1 undergoes recombination with other strains to bring forth the diverseness in Parechoviruses. The viruses are 7100 to 8500 bases long which are enclosed in an icosahedral mirid bug made up of 60 transcripts each of mirid bug proteins VP1 to VP4. Once the HPeV1 and HPeV2 were known as echovirus 22 and 23 severally. HPeV2 has 87.9 % aminoacid individuality with HPeV1 genotype. Both were foremost stray in1956 during an epidermic of summer diarrhea. The genome has four distant spheres. The 5 untranslated part ( UTR ) precedes a individual unfastened reading frame, towards downstream there is a 3untranslated part and a poly ( A ) tail. The genome encoding a individual protein is processed by many virus encoded enzymes which produces precursors that map in virus reproduction to bring forth protein eventually. Figure 1: The genome of Picorna virus with conventional representation of poly protein in Parecho virus. The peptide covalently bound to 5end. The perpendicular pointers indicate the virus encoded activities for processing proteins. The places of VP0, VP3 and VP1 are indicated as 0, 3, and 1 in the polyprotein severally ( Beginning: Stanway, G.et Al ( 1999 ) Parechoviruses.Journal of Virology, 73, 5249-5254 ) . In general, all Picorna viruses have same basic genomic organisation, but different genotypes show specific features in 5UTR construction, L and 2Aproteins and 3UTR. There exists similarity in 5UTR of Parechovirus with cardio, aphtho viruses which reflects recombinant events occurred in the development of parechoviruses. ( Stanway, G. et Al, ( 1998 ) Molecular analysis of human Parechovirus 2, Journal of General virology, 79,2641-2650 ) The Parechovirus shows assorted responses in host cells. The cleavage of mirid bug protein VP0 seen in other Picorna viruses are non found in Parechovirus. It has a alone extension at N-terminal of mirid bug protein, VP3 and 2A protein which is extremely basic in character. ( Stanway, G. et Al, ( 2000 ) Human parechoviruses- biological science and clinical significance, Reviews in Medical Virology,10,57-69. ) Many recent surveies shown that the Parechoviruses are holding high rate of pathogenicity which causes stomach flu, respiratory unwellness, feverish unwellness, skin eruption, manus, pes and oral cavity disease , sterile meningitis, herpangia. The more prevalence of Parechovirus infections are found in kids less than 3 old ages. Harmonizing to a research done by Miyabi Ito.et Al on clinical stool samples from a random population in Aichi, Japan suggests that the base and aminoacid sequence of Nipponese HPeV-3 was similar to that found in Canada and Netherlands. The survey confirms the world-wide prevalence of Human Parechovirus infection. Besides they concluded that 97 % of patients were younger than 3 old ages old, and among them 86.2 % were under 12 months old. The finding of nucleotide sequence and phyletic analysis of VP1 part and 5UTR part revealed that bulk were holding HPeV1 infection, so comes HPeV3, so HPeV4 and eventually less figure with HPeV6. They besides found some seasonal fluctuation act uponing the clinical manifestation of Parechovirus. HPeV1 detected preponderantly during autumn and winter while HPeV3 instances detected in summer and autumn. They came to a decision that there are differences in mechanism of pathogenesis between HPeV1 and HPeV3 infections. ( Miyabi Ito et Al ( 2010 ) Detection of Human Parecho virus in clinical stool samples in Aichi, Japan, Journal of Clinical Microbiology, 48, 2683-2688 ) Based on the survey of the antigenic belongingss of human Parechoviruses done by Paivi Joki Korpela. et Al, they identified the antigenic site is within VP0 polypeptide. In HPeV1 the antigenisity is in the C-terminal part. The immunological features of HPeV1 mirid bug protein was besides found out utilizing the peptide scanning techniques. ( Korpela, P.J et Al ( 2000 ) Antigenic belongingss of human parechovirus1, Journal of General Virology, 81, 1709-1718 ) Surveies reveal that HPeV infects the cardinal nervous system ( CNS ) in kids associated with terrible neonatal sepsis like unwellness, meningitis or palsy. A group of scientists under the counsel of S.Rangraj has done surveies on HPeV-CNS infection in United States. This was the first multiyear prevalence study of HPeV-CNS infection in United States. They have isolated nucleic acid from cerebrospinal fluid of kids around the Kansas City for 3 old ages 2006 to 2008. HPeV RT-PCR was used and surveies done by sequencing VP3/VP1 junction. They could observe the HPeV in 7 % cerebrospinal fluid samples taken from patients, and the sensing was seasonal from June to October. HPeV3-CNS infection was found in 71 % of male babies. Most common clinical symptoms were sepsis like unwellness ( 66 % ) , crossness ( 98 % ) , fever ( 95 % ) and non-specific roseolas ( 58.6 % ) . ( Rangaraj.S et al ( 2010 ) Human parechovirus3 doing sepsis like unwellness in kids from Midwestern United States, The Ped iatric Infections Disease Journal, www.journals.iww.com ) The prevalence of world-wide pathogenesis shown by Parechovirus is obviously proved by Pham et al by making the research in 362 fecal samples for the sensing of HPeV types in one twelvemonth 2005 to 2006. They have done the survey in many kids who got infected with stomach flu in Srilanka. Out of 362 samples, 30 were positive with HPeV ( 8.3 % ) .The genotypes isolated were HPeV1, 3,4,5,10,11. ( Pham.N.T.K et al ( 2010 ) Human Parechovirus infection in kids hospitalized with acute stomach flu in Srilanka, Journal of clinical microbiology, www.mdlinx.com ) . The viral RNA reproduction composite in HPeV1 septic cells would incorporate the viral protein and membrane changes. The structural alterations in virus septic cells include the Golgi setup decomposition and loss of ribosomes from endoplasmic Reticulum. The viral plus strand RNA and 2C viral proteins were found as bunchs of little cysts in cells. The membrane adhering belongingss of protein 2C resulted in the determination of its presence in Golgi setup and endoplasmic Reticulum. HPeV1 reproduction composite is formed by Golgi marker cysts forms a alone construction among other Picorna viruses. ( Krogerus.C et.al ( 2003 ) Replication composite of human Parechovirus 1, Journal of Virology, 77, 8512-8523 ) In this survey, the clinical sample from a kid with mild diarrhea is taken which is analysed utilizing assorted molecular techniques, in peculiar RT-PCR. The survey included the sensing and analysis of viral RNA, surmising it as HPeV by naming the particular symptoms shown by the patient. The RT-PCR is done by utilizing HPeV specific primers OL993A and OL994A. It is followed by sequencing DNA commercially in both orientations utilizing Gene service.T7 and SP6 RNA polymerase written text induction sites of pGEM ( R ) -T Easy vector is used for this intent. The Analysis of DNA sequence is done farther utilizing Bioinformatics tools. It offers a speedy method of observing Parechovirus and placing which of its genotype is present in the clinical sample. Materials and Methods All the molecular methods were done on the footing of protocol given in Stanway, G. ( 2009 ) Practical Handbook. The RNA being isolated from the clinical sample utilizing commercial kit, QIA A ( R ) viral RNA mini kit produced by Qiagen. The kit works on the rule of selective binding belongingss of silicon oxide gel. ( hypertext transfer protocol: //www1.qiagen.com/products/rnastabilizationpurification/cellviralrnapurificationsystems/qiaampviralrnaminikit.asp ) . The RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . Two primers OL993A and OL994A were used that are complimentary to the 3end of sense and anti sense strands of DNA, along with RT/PlatinumR Taq polymerase mix. The competent E.coli cells were transformed by utilizing the RT-PCR DNA and pGEM R-T Easy vector. The samples were spread to selective home bases incorporating Luria Bertani Broth. The plasmid DNA isolation was done with commercial kit, Qiagen QIA spin mini column and EcoR1 limitation digestion. The sample was so commercially sequenced utilizing Geneservice. The analysis of DNA sequence has been done with Blast plan ( hypertext transfer protocol: //www.ncbi.nlm.nih.gov/BLAST ) and alignment with Clustalw plan ( hypertext transfer protocol: //www.ebi.ac.uk/tools/clustalw/index.html ) . ( Stanway, G. ( 2009 ) BS934 Practical Handbook- Molecular Medicine Pathway ) Consequence Isolation of RNA from clinical sample: RNA set Deoxyribonucleic acid marker set Figure 2: The Agarose gel cataphoresis exposure of stray RNA sample. The RNA was isolated utilizing Qiagen viral RNA isolation kit. The cataphoresis was done along with DNA marker ( 1kb ladder supplied by Invitrogen ) and visualized the RNA set utilizing gel certification equipment. The RNA stuff was seen as a vilification on the Agarose gel. RT-PCR Deoxyribonucleic acid: Negative Control RT-PCR merchandise Deoxyribonucleic acid Marker Figure 3: The exposure of Ethidium bromide stained RT-PCR DNA after Agarose gel cataphoresis. As per the protocol given in Stanway, G. ( 2009 ) Practical Handbook, the RT-PCR has done along with negative control and marker DNA ( supplied by Invitrogen ) . It is found out that the RT-PCR DNA set has been visualised utilizing gel certification equipment. The presence of set confirmed the presence of HPeV in the clinical sample. There was no set seen in the negative control demoing the echt consequence without any kind of taint. The approximative size of the merchandise is obtained by comparing with the 1kb size criterion DNA marker set. RT-PCR calibrated secret plan for finding the molecular weight of DNA sample: Distance migrated by unknown DNA sample= 37mm Figure 4: The graph between the molecular weight of DNA marker and the distance migrated in the gel cataphoresis. The unknown molecular weight of the RT-PCR sample is calculated from the graph ( fig: 4 ) which was migrated to a distance of 37mm was found to be about 1000 bp ( reverse log 3 ) . Final gel consequence: 1 2 3 4 Figure5: The Agarose gel exposure obtained in 2010 practical. In the fig: 5, the sets were obtained for the RT-PCR DNA and EcoR1cut DNA from white settlement ( Lane 2 and 4 severally ) . There was no set formed for the EcoR1 cut DNA from the blue settlement ( Lane 3 ) . Deoxyribonucleic acid marker RT-PCR Deoxyribonucleic acid from white settlement EcoR1 cut DNA from bluish settlement EcoR1 cut DNA from white settlement Figure 6: The Agarose gel exposure from 2009 practical for comparative survey. The set formed by EcoR1 cut DNA from bluish settlement can be seen. Multiple sequence alliance of DNA sample utilizing Clustalw plan: HPeV1 GAAGATGACACAGAAAATTGCAAACAAACAATGTC-TCCAAATGAACTAGGACTCACTTC 59 HPeV6 GAGGATGATGCTGAAAACTGTAAACAAACAATATC-CCCAAATGAATTGGGTTTAACGTC 59 Consensus -GAATCTGCAGAAGAATGTAAACAGACAATATCACCCAAATGAATTGGGATTAACATC 57 HPeV4 GATGATTGCACTGAAGATTGCAAACAGACTATTTC-CCCAGATGAACTGGGTCTAACTTC 59 HPeV5 GATGATGAAGCTGAGGATTGTAAACAAACTATATC-TCCTGATGAACTAGGTCTTACCTC 59 HPeV2 GAAGATTCAGTAGAAGATTGTAAGCAAACCATTAC-ACCAACAGAATTGGGACTAACCTC 59 HPeV7 GAGGATTGTACTGAGGATTGCAAACAATCTCTATC-CCCAGATGAATTGGGCCTCACATC 59 HPeV8 GAGGATAAAGTCGAAGAATGCAAACAGACATTGTC-CCCAAATGAACTAGGCTTGACATC 59 HPeV3 GAGGACAACATGGAAAATTGTAAACAGTCCATATC-ACCAAATGAATTGGGTTTGACTTC 59 ** ** * ** ** ** * * * ** *** * ** * ** ** HPeV1 AGCCCAAGATGATGGCCCACTTGGTCAAGAAAAGCCAAATTATTTTCTCAATTTTAGGTC 119 HPeV6 AGCACAGGATGATGGACCTCTAGGTGGGGAAAAACCAAATTACTTTCTAAATTTTAGAAC 119 Consensus AGCCCAGGATGATGGACCATTGGGCGATANCAAGCCAAATTATTTCCTAAATTTCAAGTC 117 HPeV4 AGCCCAAGACGATGGTCCTCTGGGAGGTGAAAAGCCAAATTACTTCTTGAATTTTAGAGC 119 HPeV5 AGCACAAGATGATGGGCCCCTTGGAGTAGAGAAACCAAATTATTTTCTAAATTTTAGAGC 119 HPeV2 AGCACAAGATGATGGCCCTTTAGGAAATGACAAACCAAATTATTTTCTTAACTTTAAGTC 119 HPeV7 AGCCCAAGATGATGGACCTCTCGGGTCCGAGAAACCAAATTATTTCTTAAATTTTAGGGC 119 HPeV8 CGCTCAAGATGATGGGCCACTTGGCAATGAAAAACCTAATTACTTCCTCAACTTTAAAGC 119 HPeV3 AGCTCAAGATGATGGGCCTTTGGGTAATGAGAAACCAAATTATTTTTTAAACTTCAGAAC 119 ** ** ** ***** ** * ** ** ** ***** ** * ** ** * * HPeV1 GATGAATGTGGACATTTTTACTGTATCACATACTAAAGTAGATAACCTATTTGGGCGGGC 179 HPeV6 TATGAATGTGGACATTTTCACGGTATCTCATACAAAAGTGGACAATATATTTGGTCGCGC 179 Consensus TATGAATGTAGACATCTTCACTGTTTCCCACACTAAGGTGGACAACTTATTTGGAAGAGC 177 HPeV4 TGTCAATGTTGACATATTTACTGTGAGTCACACTAAAGTAGACAACATCTTTGGTAGGGC 179 HPeV5 AATTAATGTAGATATCTTTACTGTTAGTCATACTAAGGTAGATAACATTTTTGGGCGTGC 179 HPeV2 TATGAATGTTGATATCTTTACTGTCAGTCACACCAAAGTAGACAATATTTTTGGACGTGC 179 HPeV7 AATGGATGTTGATATTTTCACCGCAAGCCACACTAAAGTAGATAACATTTTTGGGCGTGC 179 HPeV8 AATAAATGTGGATATTTTCACAGTGAGCCATACAAAAGTGGATAATATTTTTGGAAGGGC 179 HPeV3 TATGAATGTTGACATTTTTACAGTAAGTCATACCAAAGTTGACAACATCTTTGGTAGAGC 179 * **** ** ** ** ** * ** ** ** ** ** ** * ***** * ** HPeV1 ATGGTTTTTTATGGAGCATACTTTCACCAATGAGGGACAATGGAGAGTGCCATTGGAATT 239 HPeV6 CTGGTTTGTGACAAGCCATGATTTTAACAATGAGGGACAATGGCCCTTAAATTTGACTTT 239 Consensus ATGGTTCTACCAGGAACACACTTTTACAGACGAAGGACAGTGGAGAGTTAATTTGGAGTT 237 HPeV4 ATGGTTTGCATATGATCATACATATAGAGATGAAGGAACCTGGAGGCAGGCTTTGGATTT 239 HPeV5 ATGGTTGGCCCTTGAACACACATTTGCAGATGATGGAACATGGAGGGCAGATTTGAATTT 239 HPeV2 TTGGTTTGCCCATGTTCATGACTTCACTAATGATGGCCTATGGAGACAGGGATTGGAATT 239 HPeV7 CTGGTACAACTCACGGCATGAATTCACAAATGGTGATCTGTGGCGTAGTTCATTGACTTT 239 HPeV8 ATGGTATTCTATGGCTCATGAATTTAGAAATGAAGGTTTGTGGAGGACTAAACTTACTTT 239 HPeV3 TTGGTATGTGACGTCTCATGACTTTAATAATGGAGATACCTGGAGGCAGAAATTAACATT 239 **** ** * * * * *** * ** HPeV1 TCCAAAACAAGGTCATGGGTCCTTATCACTGTTGTTTGCTTATTTTACTGGTGAACTGAA 299 HPeV6 TCCATTTGAAGGTCATGGCTCTTTATCATTATTGTTTGCATATTTCACTGGAGAACTAAA 299 Consensus CCCAAAACAAGGTCATGGTTCACTTTCTCTGCTATTTGCTTATTTCACAGGTGAATTAAA 297 HPeV4 CCCAAAGAAAGGCCATGGTGCCTTAACCCAATTATTTGCCTATTACTCAGGAGAATTAAA 299 HPeV5 TCCCACACAGGGTCATGGTACTCTGACAAGACTCTTCACATATTACTCTGGTGAATTAAA 299 HPeV2 TCCAAAGGAAGGGCACGGTGCCCTATCACTTCTGTTTGCCTACTTTACTGGTGAATTAAA 299 HPeV7 CCCTAAGAAAGGCCATGGGATGCTATCACAACTTTTTGCATATTTTACGGGTGAAGTGAA 299 HPeV8 CCCAAAACAAGGCCACGGTGCACTTTCACAATTTTTTGCTTATTATACTGGAGAGTTAAA 299 HPeV3 TCCAAAAGAGGGTCATGGTATGTTATCACAGTTTTTTGCTTATTTTACAGGAGAAATAAA 299 ** * ** ** ** * * * ** * ** * * ** ** * ** HPeV1 TATCCATGTTCTGTTCCTAAGTGAGAGGGGGTTTCTGAGGGTTGCACACACATATGACAC 359 HPeV6 TATACATGTTCTATTCTTGTCAGGCAAAGGCTTTTTGAGGGTTGTACACACTTATGACAC 359 Consensus CATCCATGTTTTGTTCTTAGCTGGAAAAGGATTTCTTAGAGTAGCTCATACATATGACAC 357 HPeV4 TATACATGTTTTATTCTTGAGTGAAACAGGGTTTCTGAGAGTGGCACATACTTATGACAG 359 HPeV5 TGTGCATGTACTGTATCTTAGTGACAATGGGTTCCTCCGAGTAACTCATGCCTATGACCA 359 HPeV2 CATCCATGTTCTATTTCTTAGTGATAGGGGTTTTCTCAGAGTTGGACATACATATGACAC 359 HPeV7 TATACATATCCTTTATATGGCTGAAAGAGGATTTCTTAGAGTGGCACACTCATATGACAC 359 HPeV8 TATCCATGTACTGTTTTTGTGTGAAAAAGGTTTTCTCAGAGTAGCTCACACATATGACAG 359 HPeV3 TATTCATATCCTATATATGGCAAAGCAGGGGTTCCTTAGAGTGGCTCATACATATGACAC 359 * *** * * * * ** ** * * ** ** * ****** HPeV1 TAGTAATGATCGAGTCAATTTTCTGTCATCGAACGGTGTAATAACTGTACCAGCCGGAGA 419 HPeV6 TGCTGATAATAGATTAACTAACTTGGCCTCTAATGGCGTGATCACCATACCAGCTGGAGA 419 Consensus ATCAGAAAATAGAGTTAACTTCTTGTCATCTAATGGTGTTATCACAATCCCAGCGGGAGA 417 HPeV4 TGATACAAACAGGTCTGACTTCTTCTCTTCAAACGGCGTCATCACTGTGCCCGCAGGGGA 419 HPeV5 TGATAATGACAGATCCAACTTTTTGTCATCCAATGGAGTAATTACAGTGCCAGCAGGTGA 419 HPeV2 TGAGACAAACAGAACCAATTTTTTATCATCCAGTGGCATAATTACAGTACCAGCAGGAGA 419 HPeV7 TGAGACACAGAGGGATGACTTTCTATCATCAAATGGTGTGATAACAATACCAGCTGGAGA 419 HPeV8 TGATGAGGGGCGAGATGACTTCTTGTCATCCAATGGAGTCATTACCATACCAGCTGGAGA 419 HPeV3 TGAAGATAATAGGAAAACTTTCTTGTCTTCAAATGGGGTAATAACTATCCCTGCTGGTGA 419 * * * ** * ** * ** ** * ** ** ** ** HPeV1 GCAGATGACACTTTCAGCTCCCTACTATTCAAACAAACCATTAAGAACTGTCAGAGATAA 479 HPeV6 ACAAATGTCATTATCAGCCCCTTTCTATTCTCACAAGCCATTGAGGACGGTTAGGGACAC 479 Consensus ACAAATGACATTATCTGCACCTTACTACTCAAATAAACCCCTTAGGACAGTTAGGGACAG 477 HPeV4 ACAAATGACCCTGTCAGTACCATTCTACTCTTCAAAGCCCTTGAGGACAATCAGGGATTC 479 HPeV5 ACAGATGACGCTTTCTGTGCCATTCTATTCTTCTAAACCACTTAGAACAATAAGAGAAAC 479 HPeV2 ACAGATGACACTATCTGTCCCCTCTTATTCCAACAAGCCATTACGGACAGTTAGATCATC 479 HPeV7 ACAAATGACTTTATCTGTACCATACTACTCAAATAAACCATTGAGGACTATAAGACATGA 479 HPeV8 GCAAATGTCTCTATCTGCTCCATTCTACTCACACAGGCCATTGAGAACAATTCGCAATGA 479 HPeV3 GCAGATGACACTCTCAGTACCTTTTTATTCAAACAAGCCTCTGAGGACAGTGCGCCATGA 479 ** *** * * ** * ** * ** ** * ** * * ** * * HPeV1 CAATAGTCTTGGTTATTTGATGTGCAAGCCCTTCTTGACTGGAACCTCTACTGGTAAAAT 539 HPeV6 TCACAGCTTGGGTAGGCTTATTTGCAAACCATTCCTGACTGGAACAACATCTGGCAGGAT 539 Consensus CAATAGTCTTGGGTATCTGATGTGCAAGCCATTCCTCACTGGAACAACAACAGGGAAAAT 537 HPeV4 AGCTGCTCTAGGGTATGTGATGTGTAAACCATTCATGTCTGGGACAACAGGTGGAAAGAT 539 HPeV5 TGGTGCATTAGGCAAATTAATCTGTAAACCATTGTTGTCTGGCACACATTCAGGGAAGAT 539 HPeV2 CAATGCTTTAGGTTATTTACTGTGTAAACCATTGCTAACTGGTACCAGCTCTGGTAGAAT 539 HPeV7 ATCAGCACTTGGTTTCTTGTTGTGTCAACCACTTTTATCAGGTACAGACAGGACTATTGC 539 HPeV8 GGATGCATTAGGATATTTACTATGTCAACCTATGCTTACAGGAACATCAAGTGGCAAGAT 539 HPeV3 TTCAGCATTAGGTTTTCTTATGTGTAGACCATCGATGCACGGGACTACACGAACTACTGT 539 * ** * * ** ** * ** ** * HPeV1 TGAGGTTTATCTTAGCCTGAGATGTCCAAATTTCTTTTTCCCTCTTCCTGCCCCTAAGGT 599 HPeV6 AGAAGTATATATGAGTCTCAGGTGCCCAAATTTCTTCTTTCCTGTTCCAGCACCAAAAAA 599 Consensus AGAGGTCTACCTTAGCCTGAGGTGTCCAAATTTCTTCTTTCCTCTCCCCGCGCCTAAAGT 597 HPeV4 AGAGATATATCTGAGTTTAAGATGTCCAAACCTATTCTTTCCCTTACCAGCTCCGAAACC 599 HPeV5 CGAAGTTTATTTGAGTCTCAGATGCCCTAATCTATTCTTTCCTTCTCCTGCACCTAAAGA 599 HPeV2 AGAGATATTCCTTAGCTTGAGATGTCCAAATTTCTTCTTTCCCTTACCAGCACCAAAACC 599 HPeV7 AGAAGTATATATTAGCTTAAGGTGTCCAAACTTTTTCTTTCCAGCGCCAGCACCTAGACC 599 HPeV8 TGAGGTGTATCTCAGCTTGAGGTGTCCAAATCTGTTTTTTCCAATCCCAGCACCTAAGCC 599 HPeV3 AGAAGTTTATGTTAGTTTAAGGTGCCCCAATTTCTTTTTCCCTGTACCAGCTCCTAAACC 599 ** * * * ** * ** ** ** ** * ** ** ** ** ** ** * HPeV1 TAC -G -AGTAGTCGTGCACTACGGGGTGATATGGCAAACCTTACAAATCA 647 HPeV6 CACACCACGCTCG -CAAAGTCGTGCTCTACGAGGTGATATGGCTAATTTGACAAATCA 656 Consensus AAC -A -ACTGGTCGTACTTTGCGGGGTGACTTGGCAAATTTCTCAAACCA 645 HPeV4 TGC -A -ACTAGTCGTGCTTTGCGGGGTGACATGGCAAACTTCTCAGACCA 647 HPeV5 GAA -A -ACTTCCAGAGCTTTGCGGGGTGACTTGGCAAATTTTATAGATCA 647 HPeV2 AGC -AACACGTAAATATAGAGGAGATTTGGCAACATGGTCTGACCA 644 HPeV7 AATTAATACTACA -CCAATAGGC -TACAGTAACGAAAGCCCATATGGTCAAGAACA 653 HPeV8 TGCCAATGCATTAAGGTCACTCAACCCATTTAGTGATGAAAGTCCATATG -AAGCACC 656 HPeV3 AACTGGTTCAAGG GCTACAGCAC TTTCTGATGAG 633 ** HPeV1 G 648 HPeV6 G 657 Consensus HPeV4 G 648 HPeV5 G 648 HPeV2 A 645 HPeV7 AGTGACAAC 662 HPeV8 AAT 659 HPeV3 Discussion: I have started the experiment with an premise of HPeV virus infected the kid demoing mild diarrhea. The isolation of viral genome from the clinical sample utilizing Qiagen kit ( rule: selective binding belongingss of silicon oxide gel ) and Agarose gel cataphoresis proved that the viral genome was RNA. From analyzing the Agarose gel photographic image it clearly showed that the RNA isolation was successful ( Fig: 2 ) . From the gel photographic image of RT-PCR ( Fig:3 ) , we can presume that the PCR merchandise DNA is holding a molecular weight closer to that of 1018bp in the marker DNA. By plotting the graph between the molecular weight of DNA marker with the distance migrated in the gel ( Fig:4 ) , I could turn out the approximate molecular weight of DNA sample after PCR which is closer to the false value got from gel cataphoresis. The sequences which are complimentary to the primers used were selected as primer binding sites inorder to magnify under specific thermic rhythms. The absence of set in the negative control shows the RT- PCR done was right without any taint. The RT-PCR has helped to uncover speedy DNA elaboration which is advantageous over traditional PCR. It besides collects informations in the exponential growing stage whereas traditional PCR is measured at the terminal point. The cloning of PCR merchandise done utilizing pGEM R -T easy vectors which contain T7 and SP6 RNA polymerase boosters. A group of scientist under Smeekens.S.P has done their survey on T7 booster sequence. T7 RNA polymerase which has specific adhering belongingss with T7 boosters determines the reproduction of bacteriophage. The booster specific binding was shown to be insensitive to fluctuation in the ionic strength of incubation solution but found sensitive to DNA spiral. The efficiency of polymerase-promoter unfastened composites are determination factors of written text. ( Smeekens.S.P et.al ( 1986 ) Promoter and nonspecific DNA binding by T7 RNA polymerase, Oxford diary on Nucleic acids Research,14,2811-2827 ) The chief intent of utilizing the pGEM R -T easy vector is that, it is holding multiple cloning parts. It has ampicillin opposition cistron which would do the host cell to last in Principen rich medium. There are EcoR1 limitation enzyme acknowledgment sites on both sides of ligated RT-PCR merchandise in the vector. Thus the plasmid isolation after the Transformation is done utilizing EcoR1 enzymes. The enzyme DNA ligase ligated the RT-PCR merchandise into vector. The Deoxyribonucleic acid with the vector is transformed into competent E.coli cells. The inability of E.coli to accept DNA leads to do it competent utilizing CaCl2. If the whole procedure was successful we would hold got bluish and white settlements of cloned cells in the LB stock home bases. But the bluish settlements were non able to separate decently in the thick of other ampicillin sensitive settlements. The ground for the complete growing of unwanted settlements might be due to the low concentration of Ampicillin added as experimental mistake. Thus the Principen sensitive cells besides multiplied along with cells incorporating vector and cistron of involvement. As a consequence there was no set produced in the Agarose gel cataphoresis from the bluish settlement cells. The plasmid DNA isolated from the cloned cell was used for sequencing on both orientations without the separation of fragment. The Deoxyribonucleic acid sequence is analysed utilizing the package plan. The finding of direct or indirect orientation of DNA sequence is done utilizing Blast nucleotide hunts. The T7 belonged to human parechovirus1 ( length7380 ) was direct orientation with +/+ strand while SP6 belonged to human parechovirus1 ( length 7380 ) was found to be indirect with +/- strands. The contrary compliment for SP6 was taken and the alliance done utilizing Clustalw. Then with different HPeV type sequences the consensus sequences are compared utilizing Clustalw. By analyzing the sequences and phyletic tree the sequence isolated from clinical sample has similar hereditary beginning with HPeV1 type Parechovirus. Hence it is identified that the kid is infected with Parechovirus type1 infection. Recognition: I would wish to widen my sincere gratitude to Professor Glen Stanway, University of Essex, for his support and counsel for my practical work. I am besides widening my thanks to Ms. Maysoon, PhD pupil for her support during the practical work.

Political Science Example

Political Science Example Political Science – Coursework Example Role of Government in Social Issues College: Role of Government in Social Issues The U.S government is en d to limit freedom of speech when the freedom is infringing on the rights and reputations of other people, when national security is at stake, when it is a public order and when the freedom is against the set morals (Graham, Amos & Plumptre, 2003). The government can also limit the freedom of speech where the law dictates, when it has a legitimate aim of restricting and when it finds it is necessary to restrict. This is done with the aim of not causing threat to anyone and to avoid any violation of state laws (Volokh, 2000). , the government’s role in social issues is to ensure that the state’s rationality is maintained. The Internet development has helped by offering a platform where the government can limit freedom of speech. Similarly, reading newspapers and watching news has enabled people to recognize some of the expressions that can or cannot air publicly.In t he arguments presented before the Supreme Court for both DOMA and Prop 8, the basis of sexual discrimination was that DOMA which is an anti-gay law that followed marriage laws to the end. DOMA unlike Prop 8 is against gay marriages and prohibits the state to allow gay marriages. This has resulted in the rise of discrimination on basis of sexual orientation whereby couples who are gay tend to be discriminated (Murray, 2009). However, through the passing of prop 8, gay marriages are legalised in some states in the United States bringing gay discrimination to a halt. Discrimination based on sexual orientation should not be prohibited. This is because the DOMA law is still in existence only that during the ruling it was overpowered by the voting judges. The best way that the ruling could be conducted was through opinion poll whereby the public would have a say. This way, it would have been possible to clearly get the number supporting gay unions and those rejecting it.ReferencesGraham, J., Amos, B., & Plumptre, T. (2003). Principles for good governance in the 21st century. Policy brief, 15, 1-6.Murray, M. (2009). Marriage Rights and Parental Rights: Parents, the State, and Proposition 8. Stan. JCR & CL, 5, 357. Volokh, E. (2000). Freedom of speech and information privacy: The troubling implications of a right to stop people from speaking about you. Stanford Law Review, 1049-1124.

M1A2 AND M2A1 - qualitative research Essay Example | Topics and Well Written Essays - 750 words

M1A2 AND M2A1 - qualitative research - Essay Example M1A1 Identified phenomenon in the workplace that can be explored by qualitative research method and its analysis Significance of effects of stress and attitude on employees’ productivity level is one of the workplace phenomena that can be explored by a qualitative research method. Stress defines response to a physical or mental strain and is a common factor in the workplace because of the scope of people’s lives and the work environment. People combine work and private life and the strain in balancing the two, together with effects of the demands in a worker’s personal life induces stress among workers. Personal attitudes towards other employees and work processes are also common and may be influenced by emotional stability from stress among employees. These factors dictates worker’s focus, and may influence their effectiveness and efficiencies at the workplace. It is therefore important to understand employee’s states and possible effects of the we lfare on organizational processes for managerial initiatives. Understanding stress and attitude indicators among employees and the relationship between levels of stress and employee productivity can for example help in counseling employees with the aim or reducing impacts of stress and poor attitudes in an organization (McGraw Hill, n.d.). Suitability of qualitative research method for the phenomenon: Seven characteristics of a qualitative research The differences between qualitative and quantitative research methods justify the choice of qualitative approach for the proposed study. The study’s epistemological assumptions identify social perspectives in employees’ social lives and this is a characteristic of a qualitative research. The study’s purpose that seeks to understand employees’ experiences with stress and attitude towards decision making also identifies with qualitative research as opposed to quantitative research objectives of establishing relat ionships for forecasting. The type of raw data for the study, expressions regarding stress, attitude, and ability to work, is qualitative and is therefore compatible with a qualitative method. Further, the study’s emphasis on developing an understanding on association among the factors and its non-random sampling approach of a single organization also identify the research with qualitative method. The proposed data collection strategies for, interviews and observation, that allows for simultaneous analysis, and applicable quality criteria such as credibility and dependability of data also justifies the proposed study’s suitability for a qualitative study and not a quantitative one (Agrosy University, 2005). M2A1: Description of a qualitative research scenario for the phenomenon Introduction Stress has been identifies as a significant factor to employee’s productivity levels in an organization with an inverse correlation. This also suggests a negative relationshi p between poor attitude and productivity (Bashir, 2010). The knowledge of significance of stress and attitude on productivity is however not sufficient for preventive measures and further research is necessary on the significance of different stress and attitude levels and the levels’ indicators (Hancock and Szalma, 2008). This research approach to the workplace phenomenon will therefore develop a model of stress and att

Social and Community Entrepreneurship Essay Example | Topics and Well Written Essays - 1500 words

Social and Community Entrepreneurship - Essay Example Social entrepreneurs look to market products to meet the human needs as much as possible, distinguish themselves from other social venture players by doing real things. The importance of social entrepreneurs is called by their ability to be relentlessly focused on influence and society’s changes and implementations of innovations that would help to build platforms for many people in order to enable them to think about positive impact on the global move (Osberg and Martin, 2007). The purpose of study of social entrepreneurship is to suggest factors associated with changes and how societies renew themselves. It will investigate the role of social entrepreneurs, challenges and pathway that made them move into social entrepreneurship. Since, the potential of social entrepreneurship is beyond human thought, the concrete example of such man, as the founder of Toms Company will be investigated and its nature and social impact will be studied. A concept of social entrepreneurship is already a widespread thing, according to the Global Entrepreneurship Monitor (GEM Global Report, 2014). The GEM network conducted a global survey on the adoption of social entrepreneurship among forty-nine countries. The results showed an more than one adult in forty participants were already involved into some social entrepreneurship activity (see Appendix A). In modern time, more companies become social entrepreneurs to be able to puzzle upon such social issues as increasing college enrollment rate for students with low-income and fighting with poverty by using numerous innovative nonprofits, social-purpose ventures and hybrid organizations to generate social value for the society (Noruzi, Westover and Rahimi, 2010). Wealth creation is a part of entrepreneurship, but is not the end in itself. What is more important, it is the promotion of social change that sees the opportunities to improve systems, create solutions and develop new approache s for creation of social value (see

Analyzing witchcraft in Pre-colonial and colonial Mexico Essay

Analyzing witchcraft in Pre-colonial and colonial Mexico - Essay Example Just like the smallpox and other diseases brought by the Europeans wiped out civilizations, Catholicism eradicated the native religion of Mexico. Between 1800 and 300 BC, complex cultures flourished in Mexico. Many matured into advanced pre-Columbian Mesoamerican civilizations such as the: Olmec, Teotihuacan, Maya, Toltec, and Aztec, which thrived for nearly 4,000 years before the Europeans landed in Mexico. First the religious practices of these civilizations and the effect of European colonization on the religious practices will examined. The Europeans reaction to the rituals of these cultures need to be looked at. Finally, the persecution of natives practicing witchcraft will be analyzed. The Olmec culture, especially their religious culture, can only be interpreted by archaeological measures like the Las Limas figures. The Olmec died out before Europeans came to Mexico. Cave art, digs, and other archaeological finds have shown that the Olmec religion had priests and shamans.1 Kings and rulers had to worship or link themselves to Olmec gods to prove their right to the rule.2 One author explains, â€Å"much of the art of La Venta appears to have been dedicated to rulers who dressed as gods, or to the gods themselves†.3 Olmec art shows deities like the Feathered Serpent and the Rain Spirit were already in the Mesoamerican pantheon in Olmec times.4 The Olmec believed in multi deities and spirits. Although the Olmec culture had died out before the European Conquistadors reached Mexico, speculation can be made based upon what is known about what happened to later cultures under colonization. The Catholicism that would sweep across Mexico believed in the Trinity. Anybody worshiping any deity or god other than God the Father, Jesus, or the Holy Spirit, would be considered a witch, practicing witchcraft. Although the it can not be proven conclusively, there is indications the Olmec might have

Change in Conceptions of Core and Periphery States Essay

Change in Conceptions of Core and Periphery States - Essay Example This paper analyzes in depth and details the effects of new emerging states, with high rates of economic growth and growing political influence, and their role in altering the conceptions of core and periphery. The growth of the world in recent years can be described to be particularly exemplary with strides being made all across the core and periphery states. For some advanced ideologies it has been presumed that the periphery is the log of the international development spectrum, with more honor and recognition being accosted to the core. Politics is a whole different ball game as compared to economics. The main distinguishing factor that primarily stands out in our determination of supremacy is the length of time enjoyed in terms of independence and self-support. With these parameters in place it becomes quite easy to single out the most supreme purely on this virtue. The tear that exists between genders, principalities and states is as the main factor of consideration. A close analysis, reveals see the essence behind the ideology since it is by this reason that some world affairs occurred. Most notably is the colonial era, the first and Second World War and the recent economic resections that cut across the world Women were at a disadvantage with a lot of factors playing against them residually to the effect of creating a block and entanglement between them and the developing world. Such factors were that; women were easily victimized, lacked the power and ability of confrontation and lacked the platform to begin from.

Effects tillage system, fertilization and crop protection practices on Literature review

Effects tillage system, fertilization and crop protection practices on soil quality parameters - Literature review Example It participates in the C, N, P and S transformations and plays a significant task in the decomposition of xenobiotic organic compounds and the formation of the soil structure. Microbial biomass, C and N and their ratios to the total and light fraction C and N and pools in soils of the organic systems are higher in organic systems than in conventional systems due to the enhanced decomposition of the easily available pool of soil organic matter (SOM) with increasing microbial biomass levels. The higher levels of light fraction organic matter in organically managed soils are from plant residues and manure. The higher microbial biomass in organically managed soils indicates higher quality soil organic matter responsible to nutrient mineralization and short term storage of potentially leachable nutrients indicating comparative advantage of organically managed systems over conventional ones. ... Microbial biomass specific respiration gives the status of the substrate quality and availability in the soil (Insam et al., 1996). Microbial biomass is also used to check the improvement of degraded soils over time and serves as an early indicator of changes in the total organic matter in the soil. Long term cultivation leads to decreased levels of microbial biomass due to dwindled levels of microbial activity and soil organic C pools (Kocyigit, 2008). Higher levels of microbial biomass decrease specific respiration of micro organism, which shows that micro organisms living in low quality soils respond by increasing their specific respiration. 1.1.2 Soil Basal Respiration (SBR) Soil basal respiration is the constant rate of respiration in the soil caused by changes in organic matter levels. The rate of basal respiration in the soil indicates the amount and quality of the carbon source. Basal respiration can be used to analyze the potential of the soil biota to decompose both indigen ous and antropogenically introduced (Bloem et al., 2006). Soil respiration is a key process for carbon flux to the atmosphere. Soil water content, o2 concentration and the bioavailability of carbon are the main factors that regulate soil respiration (Bloem et al., 2006). Soil basal respiration indicates the level of microbial activity in the soil and is positively correlated with biomass activity. It involves the aerobic and anaerobic energy yielding processes where the reduced organic and inorganic compounds are utilized by microbial cells and serve as primary electron donors and oxidized compounds serve as terminal electron acceptors (Bloem et al., 2006). Processes in the soil such as fermentation and abiotic processes release co2. Water is

Evolution of the relationship between the EU and China Research Paper

Evolution of the relationship between the EU and China - Research Paper Example Sino-European relations, during the era of the Cold War, were generally derivative of the imperatives of the cold war as well as the broader associations with the superpowers. Because of the ideological and political constraints of this era, the development of commercial and economic relations took the precedence (UN 7). On April 3, 1978, a trade agreement was signed between China and the European Community (EC). This agreement was extended in 1985 to a wider Trade and Cooperation Agreement (TCA). China got the status of Most Favored Nation (MFN) from the EC and embraced Beijing in the GSP (Generalized System of Preferences) provisions from 1980 (Stepan & Ostermann 20). These European Union-China relations, in the past few years, have been growing gradually. Since 2004, the People’s Republic of China has become EU’s second largest trading partner, with the Chinese customs claiming that EU is the biggest trading partner of China. An annual summit between the EU and China’s state/government heads is held, since 1998, to discuss the bilateral and global issues. Moreover, since October 2003, China and EU have recognized each other as effective ‘strategic partners’. The idea that the relations between China and EU have acquired a fresh strategic significance and gained momentum remains fundamental to their strategic partnership (Pastor & Gosset 1). According to the European Union External Service Action, the two sides commenced their relationship in 1975 and the 1985’s Trade and Cooperation Agreement came into force to govern their relationship (Para 1). EU remains the largest trading partner of China, while Chin a is its leading supplier of imports and the second biggest 2-way trading partner (European Union External Service Action Para 2). Therefore, EU and China have had bilateral relationship since 1975. The purpose of this paper is to examine the evolution of the relations between them with the main objective being examining the development of their relationship since 1975 by looking at various aspects of their association. The two sides hold annual summits as well as frequent trade, economic, and political dialogues, including more that 50 sectoral agreements and dialogues, which range from industrial policy to environmental protection, culture or education. Human rights are regularly discussed as a part of the regular political dialogue and during specific dialogues on human rights, held twice a year since 1995. This paper will also clarify that EU and China are allies but not competitors. Events (Economic and Political) Dictating their Relationship and the Key EU Policies The relatio ns between China and the EU have faced some hardships since 2005 with some scholars expressing their deep

Change in Conceptions of Core and Periphery States Essay

Change in Conceptions of Core and Periphery States - Essay Example This paper analyzes in depth and details the effects of new emerging states, with high rates of economic growth and growing political influence, and their role in altering the conceptions of core and periphery. The growth of the world in recent years can be described to be particularly exemplary with strides being made all across the core and periphery states. For some advanced ideologies it has been presumed that the periphery is the log of the international development spectrum, with more honor and recognition being accosted to the core. Politics is a whole different ball game as compared to economics. The main distinguishing factor that primarily stands out in our determination of supremacy is the length of time enjoyed in terms of independence and self-support. With these parameters in place it becomes quite easy to single out the most supreme purely on this virtue. The tear that exists between genders, principalities and states is as the main factor of consideration. A close analysis, reveals see the essence behind the ideology since it is by this reason that some world affairs occurred. Most notably is the colonial era, the first and Second World War and the recent economic resections that cut across the world Women were at a disadvantage with a lot of factors playing against them residually to the effect of creating a block and entanglement between them and the developing world. Such factors were that; women were easily victimized, lacked the power and ability of confrontation and lacked the platform to begin from.